Out-of-India - From Theory to Truth: Part 2

The Strategic Issues & International Relations Forum is a venue to discuss issues pertaining to India's security environment, her strategic outlook on global affairs and as well as the effect of international relations in the Indian Subcontinent. We request members to kindly stay within the mandate of this forum and keep their exchanges of views, on a civilised level, however vehemently any disagreement may be felt. All feedback regarding forum usage may be sent to the moderators using the Feedback Form or by clicking the Report Post Icon in any objectionable post for proper action. Please note that the views expressed by the Members and Moderators on these discussion boards are that of the individuals only and do not reflect the official policy or view of the Bharat-Rakshak.com Website. Copyright Violation is strictly prohibited and may result in revocation of your posting rights - please read the FAQ for full details. Users must also abide by the Forum Guidelines at all times.
Nilesh Oak
BRFite
Posts: 1670
Joined: 11 Aug 2016 06:14

Re: Out-of-India - From Theory to Truth: Part 2

Post by Nilesh Oak »

vishvak wrote:
shiv wrote:Nilesh I think I have both a manual of Kshnoom and a pdf of JM Chaterji. If I do I will make sure you get it.
Such books should be made default reference material in 9th standard onwards rather than exotic subjects like indology etc. that present some or other version/corollary of the same old AIT. Imagine teaching that Persians had a single holy book but not clarifying anything further.

Nilesh Oak ji if you can mention some page numbers of JM Chatterji book in your spare time. The author must have had very good command over Hindu philosophy.
Vishvak ji,

I do not have PDF of JM Chatterji book with me yet. If you have a cursory look at the link Provided few posts (above) by Shiv/A Gupta et al, you will notice that one or two page numbers may not do justice to JM argument.

--
It is then interesting to note that while sections of Shanti Parva mentioned by JM (Mahabharata Shanti Chapters ~335 and surrounding this) refer to possible evolution/revolution/split of Atharva Veda followers into many (2 or more?) branches...Chapters previous to this (Mahabharata, Shanti parva), i.e. around ~318 refer to evolution/revolution/split of Yajurveda followers into many (2) branches (Vaishampayan vs. Yajnyavalkya).

These may or may not be as distinct as Catholic/Protestant type split.
schinnas
BRFite
Posts: 1773
Joined: 11 Jun 2009 09:44

Re: Out-of-India - From Theory to Truth: Part 2

Post by schinnas »

Two interesting recent news:

Harappan Like Site unearthed in Tamil Nadu.
http://timesofindia.indiatimes.com/city ... 495353.cms

Harappan / Indus era atleast 8000 years old and ended because of poor monsoons.
http://timesofindia.indiatimes.com/indi ... 485332.cms
vishvak
BR Mainsite Crew
Posts: 5836
Joined: 12 Aug 2011 21:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by vishvak »

May be this link will be useful. It has images, with actual page numbers at bottom per image of pages.
link from avesta.org
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

peter wrote:
shiv wrote: It may be "fair" but point "b" is still complete nonsense.
How so?
shiv wrote:How interested are you in finding out? I have already made one post stating my reasons. Please read and get back if there is something that is not clear.
Very interested. I had read your post. My specific query is how is the assumption of mutation rate fixed and what relationship does it have with evolution if any?
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

shiv wrote:As a general comment on logic used for the purpose of rhetoric
1. The cow can be tied to a coconut tree to restrict its freedom
2. Coconut trees can restrict the freedom of cows
3. The name coconut milk is designed to promote coconuts and devalue cow's milk.
4. Coconut trees are the natural enemies of cows.
I would be happy for someone to take down the "logic" here but it is an illustration of the sorts of arguments used by people who call like to call themselves scholars, sometimes even on this forum.
3 does not follow 1 and 2.
fanne
BRF Oldie
Posts: 4594
Joined: 11 Feb 1999 12:31

Re: Out-of-India - From Theory to Truth: Part 2

Post by fanne »

Then Peter you are not fit to be a scholar. But if you see the logic, you can join the likes of Thappar bro and sis
gandharva
BRF Oldie
Posts: 2304
Joined: 30 Jan 2008 23:22

Re: Out-of-India - From Theory to Truth: Part 2

Post by gandharva »

Independent Origins of Indian Caste and Tribal Paternal Lineages

http://www.cell.com/current-biology/abs ... all%3Dtrue


#JustForRecords (Link given by an MT follower).
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

peter wrote: Very interested. I had read your post. My specific query is how is the assumption of mutation rate fixed and what relationship does it have with evolution if any?
I will stick to evolution because I am not arguing about the use of mutation rates - which is outside of my expertise and casual interest.

What is the connection between mutation and evolution? What is evolution? (heck I will have to make a 25,000 word post to explain but will try to be as brief as possible.

Chromosomes are long strings of "genes". Genes are parts of chromosomes. Each chromosome has many genes. Genes are long strings of "words". Each word is 3 letters long and the alphabet has only 4 letters in total. Without going into the complex and IMO utterly fascinating details - some basic maths will tell you that the language that has only 4 letters and only 3 letter words can have only 64 words in its dictionary in total. So our genetic code is a language with 64 words, and each word is a three-letter string of three molecules. (The four "alphabet" molecules are Adenine, Thymine, Guanine and Cytosine or A,T,G,C for short - but each word can be ATC or CAG etc ie only 3 letters, never 1 or 2 or 4 letters).

But the language of (human) genes requires only 21 words. 64 words is too many - so there are an extra 43 words in the dictionary and some are "nonsense words" that carry no meaning. But every word is 3 letters long. Each of the 21 "useful" is a code word that represents a biological molecule called an amino acid. There are only 21 amino acids needed for humans

Now as a small digression, all structures of living organisms are built using basic building blocks called "proteins" that can act as bricks or as construction workers. There are thousands of different proteins. Every protein is a string of hundreds or thousands of molecules called "Amino acids". These strings fold up into complex 3-D shapes and build up every living organism. The code to manufacture the "string of Amino acids" that make proteins is stored in a "string of words - those 3 letter words in each gene. . Each 3 letter word in the gene codes for one amino acid. Each gene has many such words. The whole gene, consisting of many 3 letter words codes for a long string of amino acids which will be joined together in that order to create a protein. This is the way in which a string of 3 letter code words gets translated into body building blocks. Each 3 letter code word is of course a combination of 3 molecules.

'Mutations" are an error in any of the "words". Suppose a Paki sits on a lump of Uranium and some radiation hits one of the three letter molecules of one word on a sperm inside his balls - and changes the word. That changed word will be transferred to his son when the Paki marries his cousin cum niece. Imagine the word is CCG and it changes to CAG. If that "changed word" is a nonsense word which is not associated with any amino acid, nothing will happen. But if it is a code word then the amino acid changes. The entire protein itself may get affected and it may not work. An embryo with such a mutation may not survive. If it survives - depending on the importance of the protein affected it may have a defect that is serious, or no defect at all.

In a thriving and large population of any animal, there are many mutated genes. Some may be "useful mutations" that are not seen. As long as mutations do not cause death of an animal before it produces children, that mutation will survive. Examples of such mutations in humans are mutations that cause diabetes or cancer - which may occur after the individual has had children and passed on his genes. For a different example of mutation causing evolution there may be a random mutation that grows less body hair. So will get some animals of the herd with less hair and some with more hair. But suppose - some time in the future, there is great warming of weather. The hairy animals may start dying of overheating. But the animals that carry the "less hair" mutation may survive because they are better capable of losing body heat. After some generations of very hot weather - the species will have "evolved" to a less hairy species because of one mutation caused by the replacement of one word in one gene by another word - causing less hair to grow.

Genetics is not dependent on evolution. Evolution can be explained by genetics.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

gandharva wrote:Independent Origins of Indian Caste and Tribal Paternal Lineages

http://www.cell.com/current-biology/abs ... all%3Dtrue


#JustForRecords (Link given by an MT follower).
That paper is from 2004.

Reply to that:
http://www.cell.com/ajhg/abstract/S0002 ... %2962353-2
titled:
Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists

Given any paper, go to scholar.google.com, look up the paper, see the "cited by". The #JustForRecords paper is cited 140 times. Look up the citations.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

shiv wrote:As a general comment on logic used for the purpose of rhetoric
1. The cow can be tied to a coconut tree to restrict its freedom
2. Coconut trees can restrict the freedom of cows
3. The name coconut milk is designed to promote coconuts and devalue cow's milk.
4. Coconut trees are the natural enemies of cows.
I would be happy for someone to take down the "logic" here but it is an illustration of the sorts of arguments used by people who call like to call themselves scholars, sometimes even on this forum.
1. is true.
2. overstates the case. Anything to which a rope can be tied and that cannot be easily dislodged by a cow can be used to restrict the freedom of a cow.
3. requires certain kind of literary evidence which is lacking. There is no etymological evidence. Ayurveda holds both cow's milk and coconut milk in high regard. While there are a few modern books promoting vegan food that extol coconut milk and deprecate cow's milk, the two are not placed into specific opposition to each other; and in any case these books date from long after the term "coconut milk" was coined.
4. :rotfl: of course is true. Coconut trees wait to drop their heavy produce on the heads of unsuspecting cows that are tied to them.
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

shiv wrote:
peter wrote: Very interested. I had read your post. My specific query is how is the assumption of mutation rate fixed and what relationship does it have with evolution if any?
I will stick to evolution because I am not arguing about the use of mutation rates - which is outside of my expertise and casual interest.

What is the connection between mutation and evolution? What is evolution? (heck I will have to make a 25,000 word post to explain but will try to be as brief as possible.

Chromosomes are long strings of "genes". Genes are parts of chromosomes. Each chromosome has many genes. Genes are long strings of "words". Each word is 3 letters long and the alphabet has only 4 letters in total. Without going into the complex and IMO utterly fascinating details - some basic maths will tell you that the language that has only 4 letters and only 3 letter words can have only 64 words in its dictionary in total. So our genetic code is a language with 64 words, and each word is a three-letter string of three molecules. (The four "alphabet" molecules are Adenine, Thymine, Guanine and Cytosine or A,T,G,C for short - but each word can be ATC or CAG etc ie only 3 letters, never 1 or 2 or 4 letters).

But the language of (human) genes requires only 21 words. 64 words is too many - so there are an extra 43 words in the dictionary and some are "nonsense words" that carry no meaning. But every word is 3 letters long. Each of the 21 "useful" is a code word that represents a biological molecule called an amino acid. There are only 21 amino acids needed for humans

Now as a small digression, all structures of living organisms are built using basic building blocks called "proteins" that can act as bricks or as construction workers. There are thousands of different proteins. Every protein is a string of hundreds or thousands of molecules called "Amino acids". These strings fold up into complex 3-D shapes and build up every living organism. The code to manufacture the "string of Amino acids" that make proteins is stored in a "string of words - those 3 letter words in each gene. . Each 3 letter word in the gene codes for one amino acid. Each gene has many such words. The whole gene, consisting of many 3 letter words codes for a long string of amino acids which will be joined together in that order to create a protein. This is the way in which a string of 3 letter code words gets translated into body building blocks. Each 3 letter code word is of course a combination of 3 molecules.

'Mutations" are an error in any of the "words". Suppose a Paki sits on a lump of Uranium and some radiation hits one of the three letter molecules of one word on a sperm inside his balls - and changes the word. That changed word will be transferred to his son when the Paki marries his cousin cum niece. Imagine the word is CCG and it changes to CAG. If that "changed word" is a nonsense word which is not associated with any amino acid, nothing will happen. But if it is a code word then the amino acid changes. The entire protein itself may get affected and it may not work. An embryo with such a mutation may not survive. If it survives - depending on the importance of the protein affected it may have a defect that is serious, or no defect at all.

In a thriving and large population of any animal, there are many mutated genes. Some may be "useful mutations" that are not seen. As long as mutations do not cause death of an animal before it produces children, that mutation will survive. Examples of such mutations in humans are mutations that cause diabetes or cancer - which may occur after the individual has had children and passed on his genes. For a different example of mutation causing evolution there may be a random mutation that grows less body hair. So will get some animals of the herd with less hair and some with more hair. But suppose - some time in the future, there is great warming of weather. The hairy animals may start dying of overheating. But the animals that carry the "less hair" mutation may survive because they are better capable of losing body heat. After some generations of very hot weather - the species will have "evolved" to a less hairy species because of one mutation caused by the replacement of one word in one gene by another word - causing less hair to grow.

Genetics is not dependent on evolution. Evolution can be explained by genetics.
That makes sense! So when we say M420 or M17 or M... what does it mean? Also if you can throw some light on what differentiates M17 from Z93?
Last edited by peter on 31 May 2016 05:40, edited 1 time in total.
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

fanne wrote:Then Peter you are not fit to be a scholar. But if you see the logic, you can join the likes of Thappar bro and sis
Are you praising me or criticizing me? See I am not even smart enough to understand that.
RoyG
BRF Oldie
Posts: 5619
Joined: 10 Aug 2009 05:10

Re: Out-of-India - From Theory to Truth: Part 2

Post by RoyG »

peter wrote:
fanne wrote:Then Peter you are not fit to be a scholar. But if you see the logic, you can join the likes of Thappar bro and sis
Are you praising me or criticizing me? See I am not even smart enough to understand that.
It depends on your frame of mind. It can be criticism, sarcasm, satire etc.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

peter wrote: That makes sense! So when we say M420 or M17 or M... what does it mean? Also if you can throw some light on what differentiates M17 from Z93?
1. The human Y-chromosome is some 21,753,000 base pairs long. (PS: see *** below)
( https://en.wikipedia.org/wiki/Single-nu ... #Databases )

2. You can use ybrowse.org to look at the base pairs.

3. From there
http://ybrowse.org/gb2/gbrowse_details/ ... 3Adatabase

Code: Select all

M17 Details
Name: 	M17
Type: 	snp
Source: 	indel
Position: 	ChrY:21733168..21733168 (+ strand)
Length: 	1
allele_anc: 	ins
allele_der: 	del
comment: 	G10.47a
count_derived: 	95
count_tested: 	791
isogg_haplogroup: 	R1a1a
load_id: 	M17
mutation: 	4G to 3G
primer_f: 	M18_F
primer_r: 	M18_R
ref: 	Underhill et al. 1997
ycc_haplogroup: 	R1a1a
primary_id: 	210042
gbrowse_dbid: 	chrY:database
The key fields for our purposes in this post, as far as I can tell are:

Code: Select all

Name: 	M17
Type: 	snp
Source: 	indel
Position: 	ChrY:21733168..21733168 (+ strand)
Length: 	1
mutation: 	4G to 3G
This is a SNP (Single Nucleotide Polymorphism) - a variation in a single base pair of the DNA/
Its position is at base pair # 21,733,168.
The source: indel means that it is a deletion of a base pair.
The mutation: 4G to 3G means that the non-M17 has a G-G-G-G sequence, and M-17 has G-G-G -- one G got deleted.
Of course it means on the other strand non-M17 has a C-C-C-C sequence and M-17 has a C-C-C sequence.

---
*** PS:
http://bmcresnotes.biomedcentral.com/ar ... 015-1130-z
About the Y chromosome:
The MSY consists of about 56.4 million base pairs (Mbp), excluding about 3 Mbp of the two telomeric pseudoautosomal regions (PAR) that recombine with the X chromosome. Only 23.1 Mbp have been mapped in the assembled human reference sequence (Hg 19, GRCh37), since the rest is made up of repetitive constitutive heterochromatin in the centromere and in the long arm of the chromosome that is essentially unreadable.
Last edited by A_Gupta on 31 May 2016 08:31, edited 1 time in total.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

Here is Z93:
http://ybrowse.org/gb2/gbrowse_details/ ... 3Adatabase

Code: Select all

Z93 Details
Name: 	Z93
Type: 	snp
Source: 	point
Position: 	ChrY:7552356..7552356 (+ strand)
Length: 	1
allele_anc: 	G
allele_der: 	A
comment: 	Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
count_derived: 	117
count_tested: 	418
isogg_haplogroup: 	R1a1a1b2
load_id: 	Z93
mutation: 	G to A
primer_f: 	Z93_F CAAACAAAAATAAGAGTCACATTATGC
primer_r: 	Z93_R CAACAATGTCAAAGAATCATGATTC
ref: 	http://dna-forums.org/
ycc_haplogroup: 	R1a-M417
primary_id: 	210064
gbrowse_dbid: 	chrY:database
Basically at Y-chromosome position 7,552,356, a G turned into an A, and that is Z-93.

----
OK, what do these positions mean, if along the length of the chromosome some bases are inserted and others deleted in some place; and in other places there is a substitution. There is no "canonical" DNA against which to compare everything, except that established by convention.

---

If all Z93s found so far have M17, but not all M17 have Z93, then it is a good guess that M17 happened before Z93. Remember, Z93 is a G turned into A at position 7,552,356. M17 is 4 Gs turned into 3 Gs at position 21,733,168.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

The URLs I've posted above are flaky - sometimes they work, sometimes not.

This page is worth pondering over:
http://www.isogg.org/tree/ISOGG_HapgrpRPrivNotes.html

E.g., from there:
http://mcewanjc.org/p25.htm


P25 is an unreliable SNP and should be treated with caution

It is commonly assumed that when a SNP mutates, for most genealogical purposes it is what is called a “unique event polymorphism” or UEP. What this means is that it happens only once in one individual and it does not revert. This assumption is nearly but not quite correct, because each individual has about a 1 in 50,000,000 chance of mutating at that SNP. Given the number of people in the world some must have mutated. However, in the past the world population was much smaller and this assumption is reasonably reliable. In the Y chromosome tree some SNPs have reverted, but most have not. When they have reverted they have been typically widely separated in space and time and are easily recognizable.



P25 is a SNP but is located in an unusual portion of the Y chromosome which has been duplicated 3 times. A diagram of the P25 region is shown in Fig. 1 below from Adams et al (2006) who investigated reversion this SNP. Such duplicated regions can be subject to a process called “gene conversion” or “recombinatorial loss of heterozygosity” or RecLOH for short. This process essentially swaps the duplicated regions and its signature is loss of any variability that was present between the regions. The process is explained in Wikipedia. The consequence is that while this is still a rare process it can be much more frequent that mutation of a SNP.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

http://journals.plos.org/plosone/articl ... ne.0050269
From 2012:
Population Differentiation of Southern Indian Male Lineages Correlates with Agricultural Expansions Predating the Caste System
Abstract

Previous studies that pooled Indian populations from a wide variety of geographical locations, have obtained contradictory conclusions about the processes of the establishment of the Varna caste system and its genetic impact on the origins and demographic histories of Indian populations. To further investigate these questions we took advantage that both Y chromosome and caste designation are paternally inherited, and genotyped 1,680 Y chromosomes representing 12 tribal and 19 non-tribal (caste) endogamous populations from the predominantly Dravidian-speaking Tamil Nadu state in the southernmost part of India. Tribes and castes were both characterized by an overwhelming proportion of putatively Indian autochthonous Y-chromosomal haplogroups (H-M69, F-M89, R1a1-M17, L1-M27, R2-M124, and C5-M356; 81% combined) with a shared genetic heritage dating back to the late Pleistocene (10–30 Kya), suggesting that more recent Holocene migrations from western Eurasia contributed <20% of the male lineages. We found strong evidence for genetic structure, associated primarily with the current mode of subsistence. Coalescence analysis suggested that the social stratification was established 4–6 Kya and there was little admixture during the last 3 Kya, implying a minimal genetic impact of the Varna (caste) system from the historically-documented Brahmin migrations into the area. In contrast, the overall Y-chromosomal patterns, the time depth of population diversifications and the period of differentiation were best explained by the emergence of agricultural technology in South Asia. These results highlight the utility of detailed local genetic studies within India, without prior assumptions about the importance of Varna rank status for population grouping, to obtain new insights into the relative influences of past demographic events for the population structure of the whole of modern India.
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4709632/
Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup
This is a 2016 paper.
Abstract:
The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. Two branches of J2-M172, J2a-M410 and J2b-M102 make a considerable part of Y chromosome gene pool of the Indian subcontinent. We investigated the Neolithic contribution of demic dispersal from West to Indian paternal lineages, which majorly consists of haplogroups of Late Pleistocene ancestry. To accomplish this, we have analysed 3023 Y-chromosomes from different ethnic populations, of which 355 belonged to J2-M172. Comparison of our data with worldwide data, including Y-STRs of 1157 individuals and haplogroup frequencies of 6966 individuals, suggested a complex scenario that cannot be explained by a single wave of agricultural expansion from Near East to South Asia. Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent.
Conclusion:
Absence or negligible presence of classical markers of Eurasian demic diffusion in India advocates against it to be the sole explanation of J2a-M410 and J2b-M102 distribution in the subcontinent. High variance, haplotype diversity with no sharing haplotype, geographically pronounced phylogeny and seemingly autochthonous origin of sublineage J2a-M68, suggest towards the antiquity of the HGs. Dispersal of J2a-M410 and J2b-M102 from Near East to NW region and further eastwards of the subcontinent seems to have unique and complex history of various known and unknown possible events. Regardless of the complexity of dispersal, NW region appears to be the corridor for entry of these haplogroups into India. Remarkable presence of J2a-M410 among tribal groups inhabited in remote geographical regions strongly dismisses the earlier belief of it to be caste-specific.
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

A_Gupta wrote:
peter wrote: That makes sense! So when we say M420 or M17 or M... what does it mean? Also if you can throw some light on what differentiates M17 from Z93?
1. The human Y-chromosome is some 21,753,000 base pairs long. (PS: see *** below)
( https://en.wikipedia.org/wiki/Single-nu ... #Databases )

2. You can use ybrowse.org to look at the base pairs.

3. From there
http://ybrowse.org/gb2/gbrowse_details/ ... 3Adatabase

Code: Select all

M17 Details
Name: 	M17
Type: 	snp
Source: 	indel
Position: 	ChrY:21733168..21733168 (+ strand)
Length: 	1
allele_anc: 	ins
allele_der: 	del
comment: 	G10.47a
count_derived: 	95
count_tested: 	791
isogg_haplogroup: 	R1a1a
load_id: 	M17
mutation: 	4G to 3G
primer_f: 	M18_F
primer_r: 	M18_R
ref: 	Underhill et al. 1997
ycc_haplogroup: 	R1a1a
primary_id: 	210042
gbrowse_dbid: 	chrY:database
The key fields for our purposes in this post, as far as I can tell are:

Code: Select all

Name: 	M17
Type: 	snp
Source: 	indel
Position: 	ChrY:21733168..21733168 (+ strand)
Length: 	1
mutation: 	4G to 3G
This is a SNP (Single Nucleotide Polymorphism) - a variation in a single base pair of the DNA/
Its position is at base pair # 21,733,168.
The source: indel means that it is a deletion of a base pair.
The mutation: 4G to 3G means that the non-M17 has a G-G-G-G sequence, and M-17 has G-G-G -- one G got deleted.
Of course it means on the other strand non-M17 has a C-C-C-C sequence and M-17 has a C-C-C sequence.

---
*** PS:
http://bmcresnotes.biomedcentral.com/ar ... 015-1130-z
About the Y chromosome:
The MSY consists of about 56.4 million base pairs (Mbp), excluding about 3 Mbp of the two telomeric pseudoautosomal regions (PAR) that recombine with the X chromosome. Only 23.1 Mbp have been mapped in the assembled human reference sequence (Hg 19, GRCh37), since the rest is made up of repetitive constitutive heterochromatin in the centromere and in the long arm of the chromosome that is essentially unreadable.
Great information!

What is meaning/significance of position? Where is the zero position situated at?

Also what does count_derived and count_tested means? Same query of primer_r and primer_f.
JE Menon
Forum Moderator
Posts: 7148
Joined: 01 Jan 1970 05:30

Re: Out-of-India - From Theory to Truth: Part 2

Post by JE Menon »

Hindu Architecture in India & Abroad - Prasanna Kumar Acharya, 1946

http://asi.nic.in/asi_books/10875.pdf

Includes the following nugget on page 16: "While the influence of Hindu culture on Chinese and Japanese civilizations is generally known and acknowledged, it would be news to many that the Yucatan Peninsula, in the Mexican territory of Central America, contains some Hindu monuments. The Mayan manuscript book records the migration to America of the clans, whose chief, Maya, is stated in the great Indian Epic to have built a wonderful audience hall for the King Yudhistira... The conclusion of Professor Elliot Smith, of University College, London, which is gratefully reiterated here, 'was that the Maya civilization of Central America was directly derived from India'"
A_Gupta
BRF Oldie
Posts: 15935
Joined: 23 Oct 2001 11:31
Contact:

Re: Out-of-India - From Theory to Truth: Part 2

Post by A_Gupta »

peter wrote:What is meaning/significance of position? Where is the zero position situated at?
This supergiant molecule of DNA is like a long thread. Position is position on this thread. One end of the long strand of DNA is the zero position.
Also what does count_derived and count_tested means? Same query of primer_r and primer_f.
a. I don't know, and b. it is irrelevant to understanding genetics in the context of "Out of India".
Presumably, if you are really interested, you can find out by browsing through ybrowser.org.
And if you are really, really interested, you will find or start a genetics topic, say, in the Tech forum and help increase our collective BRF knowledge.
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

A_Gupta wrote:
peter wrote:What is meaning/significance of position? Where is the zero position situated at?
This supergiant molecule of DNA is like a long thread. Position is position on this thread. One end of the long strand of DNA is the zero position.
Also what does count_derived and count_tested means? Same query of primer_r and primer_f.
a. I don't know, and b. it is irrelevant to understanding genetics in the context of "Out of India".
Presumably, if you are really interested, you can find out by browsing through ybrowser.org.
And if you are really, really interested, you will find or start a genetics topic, say, in the Tech forum and help increase our collective BRF knowledge.
Ok I admit I am stupid. I tried browsing ybrowser.org for Z92. But I could not find a link to click which would give information like you posted above for Z93.

Would you be kind enough to throw some light on this as in how to search on ybrowser?

Let me muddle through some data before i post on the tech forum.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

peter wrote: What is meaning/significance of position? Where is the zero position situated at?
Each human chromosome is two strings (one string from mother, and one string from father) attached to each other at the center. This central attachment point is called the centromere and chromosomes get their cross shapes because they are 2 strings attached at the center. One "arm" of the cross is longer than the other and that is the "p" arm. The other is the "q" arm. Counting starts from the centromere and you get p1,p2 etc and q1, q2 etc

Each "arm" is a very long very delicate string of molecules as I described in my last post above. The string consists of only 4 different types of molecules called "bases". These 4 different molecules are the 4 letter "alphabet" of genes. The molecules are called nucleotides and have the names Adenine, Thymine, Guanine and Cytosine (A,T,G,C) for short. The funny thing about nucleotides is that they form two pairs like Laila will always go for Majnu and Romeo will always go for Juliet. In the same way Adenine on one half of the chromosome string will only link with Thymine on the other arm. Guanine will always link with Cytosine. These are called "base pairs" and each half of a chromosome is an "mirror" image of the other except that where one has adenine the other has thymine, and where one had guanine the other has cytosine. If you have one string you can infer or reproduce the other.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

peter wrote: Ok I admit I am stupid. I tried browsing ybrowser.org for Z92. But I could not find a link to click which would give information like you posted above for Z93.

Would you be kind enough to throw some light on this as in how to search on ybrowser?

Let me muddle through some data before i post on the tech forum.
By all means play with the information on that site but I doubt if it will fetch you anything useful in terms of OIT/AIT.

What genticists talk about are "single nucleotide polymorphisms" (SNPs) where
Single=one
nucleotide= Adenosine, Thymine, Guanine or Cytosine (A,T,G or C)
poly=many
morph=shape or form

Ideally a genetic researcher will look at M17 from hundred or preferably thousands of individuals from different parts of the world. Some percentage of these people will have "SNPs" - ie one base is replaced by another - eg A by G. In some cases this is seen to occur in only one person or in one family. These have to be ignored. But there are other SNPs that are common across a large percentage of people and these indicate "useful mutations" that can be studied to look at where thy may have originated or where they came from.

An illustration of this comes from this paper
http://www.nature.com/ejhg/journal/v18/ ... 9194a.html
Here we present frequency and haplotype diversity estimates for more than 2000 R1a chromosomes assessed for several newly discovered SNP markers that introduce the onset of informative R1a subdivisions by geography. Marker M434 has a low frequency and a late origin in West Asia bearing witness to recent gene flow over the Arabian Sea. Conversely, marker M458 has a significant frequency in Europe, exceeding 30% in its core area in Eastern Europe and comprising up to 70% of all M17 chromosomes present there. The diversity and frequency profiles of M458 suggest its origin during the early Holocene and a subsequent expansion likely related to a number of prehistoric cultural developments in the region. Its primary frequency and diversity distribution correlates well with some of the major Central and East European river basins where settled farming was established before its spread further eastward. Importantly, the virtual absence of M458 chromosomes outside Europe speaks against substantial patrilineal gene flow from East Europe to Asia, including to India, at least since the mid-Holocene.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

Taking a link from what Arun posted earlier:
The Genetic Heritage of the Earliest Settlers Persists Both in Indian Tribal and Caste Populations
What the paragraph below says is that there has been limited gene flow into India since the holocene era (last 10-12,000 years) and most of the mixing occurred before that in the Pleistocene era. There are so many fukin paper that say the same thing that i think the Aryn Invasion Theory of Indo European people reaching India by 1000 BC has bee thoroughly discredited.

This Kivisilid paper too has been posted before on this thread,
In mtDNA phylogenetic analyses, the Chenchus and Koyas coalesce at Indian-specific branches of haplogroups M and N that cover populations of different social rank from all over the subcontinent. Coalescence times suggest early late Pleistocene settlement of southern Asia and suggest that there has not been total replacement of these settlers by later migrations. H, L, and R2 are the major Indian Y-chromosomal haplogroups that occur both in castes and in tribal populations and are rarely found outside the subcontinent. Haplogroup R1a, previously associated with the putative Indo-Aryan invasion, was found at its highest frequency in Punjab but also at a relatively high frequency (26%) in the Chenchu tribe. This finding, together with the higher R1a-associated short tandem repeat diversity in India and Iran compared with Europe and central Asia, suggests that southern and western Asia might be the source of this haplogroup. Haplotype frequencies of the MX1 locus of chromosome 21 distinguish Koyas and Chenchus, along with Indian caste groups, from European and eastern Asian populations. Taken together, these results show that Indian tribal and caste populations derive largely from the same genetic heritage of Pleistocene southern and western Asians and have received limited gene flow from external regions since the Holocene. The phylogeography of the primal mtDNA and Y-chromosome founders suggests that these southern Asian Pleistocene coastal settlers from Africa would have provided the inocula for the subsequent differentiation of the distinctive eastern and western Eurasian gene pools.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

A_Gupta wrote:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4709632/
Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup
This is a 2016 paper.
Abstract:
The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. Two branches of J2-M172, J2a-M410 and J2b-M102 make a considerable part of Y chromosome gene pool of the Indian subcontinent. We investigated the Neolithic contribution of demic dispersal from West to Indian paternal lineages, which majorly consists of haplogroups of Late Pleistocene ancestry. To accomplish this, we have analysed 3023 Y-chromosomes from different ethnic populations, of which 355 belonged to J2-M172. Comparison of our data with worldwide data, including Y-STRs of 1157 individuals and haplogroup frequencies of 6966 individuals, suggested a complex scenario that cannot be explained by a single wave of agricultural expansion from Near East to South Asia. Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent.
Conclusion:
Absence or negligible presence of classical markers of Eurasian demic diffusion in India advocates against it to be the sole explanation of J2a-M410 and J2b-M102 distribution in the subcontinent. High variance, haplotype diversity with no sharing haplotype, geographically pronounced phylogeny and seemingly autochthonous origin of sublineage J2a-M68, suggest towards the antiquity of the HGs. Dispersal of J2a-M410 and J2b-M102 from Near East to NW region and further eastwards of the subcontinent seems to have unique and complex history of various known and unknown possible events. Regardless of the complexity of dispersal, NW region appears to be the corridor for entry of these haplogroups into India. Remarkable presence of J2a-M410 among tribal groups inhabited in remote geographical regions strongly dismisses the earlier belief of it to be caste-specific.
Yet another AIT killer
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

shiv wrote:
peter wrote: What is meaning/significance of position? Where is the zero position situated at?
Each human chromosome is two strings (one string from mother, and one string from father) attached to each other at the center. This central attachment point is called the centromere and chromosomes get their cross shapes because they are 2 strings attached at the center. One "arm" of the cross is longer than the other and that is the "p" arm. The other is the "q" arm. Counting starts from the centromere and you get p1,p2 etc and q1, q2 etc

Each "arm" is a very long very delicate string of molecules as I described in my last post above. The string consists of only 4 different types of molecules called "bases". These 4 different molecules are the 4 letter "alphabet" of genes. The molecules are called nucleotides and have the names Adenine, Thymine, Guanine and Cytosine (A,T,G,C) for short. The funny thing about nucleotides is that they form two pairs like Laila will always go for Majnu and Romeo will always go for Juliet. In the same way Adenine on one half of the chromosome string will only link with Thymine on the other arm. Guanine will always link with Cytosine. These are called "base pairs" and each half of a chromosome is an "mirror" image of the other except that where one has adenine the other has thymine, and where one had guanine the other has cytosine. If you have one string you can infer or reproduce the other.
ok. clearer.
So p1,p2 etc and q1,q2 etc are the positions where mutations can take place?.
Looking at this picture:
Image

starting from top can we number the positions as 0,1, and so forth?
But this picture has two letters forming a connect not four? Starting from top TA, then GC.

Since M17 is at position 21733168..21733168 how does 4Gs connect since the space seems to be only for 2 letters as in the above picture?
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

peter wrote: Since M17 is at position 21733168..21733168 how does 4Gs connect since the space seems to be only for 2 letters as in the above picture?
Sorry. Cannot understand your question. Don't know what you mean by two and four. A single nucleotide change is one change. Not two or four. And the change can be from any of the four nucleotides to any other, or even the deletion of one at some point (as in M17) or the insertion of one.

I think you need to Google for a primer on genetics and figure out some stuff for yourself because it is too much effort for me to hold your hand. You have not understood the basics but you are jumping to postgraduate level. I don't blame you for not having fully understood what I have typed earlier but one cannot give a genetics lesson in such a short space. Please don't come up with idiotic remarks like "I'm stupid". But you may be lazy. Too lazy to start from the basics and read it yourself. I think I have put in enough effort spoonfeeding you. No more unless you can grasp the basics yourself. Try looking up "mutation" and "single nucleotide polymorphism"
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

Posting for the record. Picks holes in AIT and points to evidence of OIT
http://indiafacts.org/andronovo-cradle-indo-iranians/
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

shiv wrote:
peter wrote: Since M17 is at position 21733168..21733168 how does 4Gs connect since the space seems to be only for 2 letters as in the above picture?
Sorry. Cannot understand your question. Don't know what you mean by two and four. A single nucleotide change is one change. Not two or four. And the change can be from any of the four nucleotides to any other, or even the deletion of one at some point (as in M17) or the insertion of one.
Agupta wrote: If all Z93s found so far have M17, but not all M17 have Z93, then it is a good guess that M17 happened before Z93. Remember, Z93 is a G turned into A at position 7,552,356. M17 is 4 Gs turned into 3 Gs at position 21,733,168.
I see only 2 letters connected to each other as in this picture thyamine is connected to adenine and cytosine to guanine. Image

How do 4Gs turn into 3Gs at a single location as Agupta is suggesting? From the picture it seems it is possible for 2Gs to turn into a 1G. Since 4Gs as in Gunanine connected to another guanine connected to another G to another G is not even possible.

Now about lazy and all you could be right but since you did not ask me how much time I spend/ have spent understanding this subject it is uninformed to label me.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

M17 showing point of deletion of one G at point 21733168
Image
Prem Kumar
BRF Oldie
Posts: 4749
Joined: 31 Mar 2009 00:10

Re: Out-of-India - From Theory to Truth: Part 2

Post by Prem Kumar »

Please read the link sent by Shiv above. Its an article by Koenraad Elst in IndiaFacts. AIT-wallahs love to throw around words like Andronovo, BMAC etc.

This article explains why Andronovo culture is likely Indo-Iranian and likely the result of OIT

http://indiafacts.org/andronovo-cradle-indo-iranians/
gandharva
BRF Oldie
Posts: 2304
Joined: 30 Jan 2008 23:22

Re: Out-of-India - From Theory to Truth: Part 2

Post by gandharva »

shiv wrote:
A_Gupta wrote:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4709632/
Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup
This is a 2016 paper.
Abstract:
The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. Two branches of J2-M172, J2a-M410 and J2b-M102 make a considerable part of Y chromosome gene pool of the Indian subcontinent. We investigated the Neolithic contribution of demic dispersal from West to Indian paternal lineages, which majorly consists of haplogroups of Late Pleistocene ancestry. To accomplish this, we have analysed 3023 Y-chromosomes from different ethnic populations, of which 355 belonged to J2-M172. Comparison of our data with worldwide data, including Y-STRs of 1157 individuals and haplogroup frequencies of 6966 individuals, suggested a complex scenario that cannot be explained by a single wave of agricultural expansion from Near East to South Asia. Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent

Conclusion:
Absence or negligible presence of classical markers of Eurasian demic diffusion in India advocates against it to be the sole explanation of J2a-M410 and J2b-M102 distribution in the subcontinent. High variance, haplotype diversity with no sharing haplotype, geographically pronounced phylogeny and seemingly autochthonous origin of sublineage J2a-M68, suggest towards the antiquity of the HGs. Dispersal of J2a-M410 and J2b-M102 from Near East to NW region and further eastwards of the subcontinent seems to have unique and complex history of various known and unknown possible events. Regardless of the complexity of dispersal, NW region appears to be the corridor for entry of these haplogroups into India. Remarkable presence of J2a-M410 among tribal groups inhabited in remote geographical regions strongly dismisses the earlier belief of it to be caste-specific]
Yet another AIT killer
How does this impact AIT? Isn't neolithic age 10K-2K BC is prior to Aryan invasion?
peter
BRFite
Posts: 1207
Joined: 23 Jan 2008 11:19

Re: Out-of-India - From Theory to Truth: Part 2

Post by peter »

shiv wrote:M17 showing point of deletion of one G at point 21733168
Image
Yes. But this is what Agupta posted earlier:

Code: Select all

M17 Details
Name: 	M17
Type: 	snp
Source: 	indel
Position: 	ChrY:21733168..21733168 (+ strand)
Length: 	1
allele_anc: 	ins
allele_der: 	del
comment: 	G10.47a
count_derived: 	95
count_tested: 	791
isogg_haplogroup: 	R1a1a
load_id: 	M17
mutation: 	4G to 3G
primer_f: 	M18_F
primer_r: 	M18_R
ref: 	Underhill et al. 1997
ycc_haplogroup: 	R1a1a
primary_id: 	210042
gbrowse_dbid: 	chrY:database
and shows "mutation: 4G to 3G". What does this mean?
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

peter wrote: and shows "mutation: 4G to 3G". What does this mean?
It means that a string that used to have 4 Gs in a row got zapped in a mutation and became 3 Gs in a row. The particular G that got zapped is marked by that position number and is clearly marked on the image I have posted. You can see 4 Gs in a row and the symbol M17 under the last G on the right.

While G binds to C or A to T, there is no law that 2 or 4 or 72 or 420 or 786 Gs cannot be strung together in one row on one strand of DNA. That is how you get 4 Gs in a row

The information is useless for this discussion but I will keep posting replies as long as I find it entertaining. I would not recommend this forum for learning about genetics and I just wonder what point you are trying to prove by persistently bashing one arcane point posted by someone and saying you don;t understand. Sometimes that could be trolling. It should be possible to find out whether you want to learn or want to troll based on who or what you look at as a source of credible information. IMHO. You know that this forum cannot be the place to learn about genetics.
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

gandharva wrote: How does this impact AIT? Isn't neolithic age 10K-2K BC is prior to Aryan invasion?
:D Interestingly worded question.

I do not believe that there was any invasion of Aryans carrying language to India around 1500 to 1000 BC, so I cannot accept that some event was "prior to Aryan invasion". There was no Aryan invasion

But yes the neolithic age is prior to the quoted dates of the hypothetical Aryan invasion, and that complicates the Aryan invasion theory by upsetting its timeline.

The Aryan Invasion Theory is not about just any migration. It is about how a language (belonging to what they call the Aryan language family - now renamed 'Indo-European language family) was brought to India from the west via the North West route. That theory has specific dates based on lingusitics. The Aryan language reached Syria around 1700-1800 BC from Eurasia (or Europe) where the language is claimed to have originated before which those Syrians were speaking semitic languages. Later - by 1500-1200 BC the language reached India with Aryans who came from the west. But the Aryans themselves already existed in Eurasia (or Europe) speaking a mother language in Europe/Eurasia before 3000 BC and that language is nowadays called PIE.

So if Aryan language speakers were already there in Eurasia by 3000 BC who were the people who are supposed to have come to India in the neolithic period? Does it mean that the language reached India by demic diffusion before 1500 BC as claimed by the Aryan Invasion Theory? If the language reached India earlier than 2000 BC (Neolithic) then the idea that the language reached Syria in 1800-1700 BC before going to India is falsified. That linguistic theory has to be discarded.

So one might ask "OK so what? maybe the language did reach India before 2000 BC and it did come from the West". This is a new form of Aryan Invasion theory that claims that the language came by demic diffusion along with Agriculture. The paper linked by Arun Gupta addresses this theory and says that this demic diffusion model of language spread is unlikely

The paper starts with the statement:
It is pertinent that paternal gene pool of India comprises mainly HGs of autochthonous origin of Late Pleistocene ancestry and received very little gene flow from outside
But the paper says that it is going to concentrate on Haplogroup J2-M172 (and its branches) to see where it fits in the scheme of things. The paper concludes that migrations into India have occurred as early as the late Pleistocene - i.e more than 10,000 years ago.
Absence or negligible presence of classical markers of Eurasian demic diffusion in India advocates against it to be the sole explanation
Another frequently forgotten aspect of the Aryan Invasion theory is that Aryans in the north set up the caste system to exclude the black tribals of the south. This paper finds no genetic support for that
Remarkable presence of J2a-M410 among tribal groups inhabited in remote geographical regions strongly dismisses the earlier belief of it to be caste-specific.
However the paper finds that the branches of the haplogroup J2-M172 that this paper concentrates upon
1. Occurred in 355 out of 3000 plus Indian samples (about 12%)
2. it is most likely to have come from the North West of India
3. It shows evidence of having started coming in more than 10 to 12000 years ago

These findings show very ancient migrations and the all go against the Aryan Invasion Theory as proposed by linguists - and as accepted today because there is ZERO evidence of language from Europe or Eurasia prior to 1000 BC or so. What people are unwilling to see is that the language in India has (in the form of ancient texts) has internal evidence that takes it back to as far as 8000 BC
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

Prem Kumar wrote:Please read the link sent by Shiv above. Its an article by Koenraad Elst in IndiaFacts. AIT-wallahs love to throw around words like Andronovo, BMAC etc.

This article explains why Andronovo culture is likely Indo-Iranian and likely the result of OIT

http://indiafacts.org/andronovo-cradle-indo-iranians/
In fact Elst points out that there is evidence of people and culture flow from the India-Iran region westwards. He takes an AIT book and uses the information in that book to show the inconsistencies.
gandharva
BRF Oldie
Posts: 2304
Joined: 30 Jan 2008 23:22

Re: Out-of-India - From Theory to Truth: Part 2

Post by gandharva »

shiv wrote:
gandharva wrote: How does this impact AIT? Isn't neolithic age 10K-2K BC is prior to Aryan invasion?
:D Interestingly worded question.

I do not believe that there was any invasion of Aryans carrying language to India around 1500 to 1000 BC, so I cannot accept that some event was "prior to Aryan invasion". There was no Aryan invasion

But yes the neolithic age is prior to the quoted dates of the hypothetical Aryan invasion, and that complicates the Aryan invasion theory by upsetting its timeline.

The Aryan Invasion Theory is not about just any migration. It is about how a language (belonging to what they call the Aryan language family - now renamed 'Indo-European language family) was brought to India from the west via the North West route. That theory has specific dates based on lingusitics. The Aryan language reached Syria around 1700-1800 BC from Eurasia (or Europe) where the language is claimed to have originated before which those Syrians were speaking semitic languages. Later - by 1500-1200 BC the language reached India with Aryans who came from the west. But the Aryans themselves already existed in Eurasia (or Europe) speaking a mother language in Europe/Eurasia before 3000 BC and that language is nowadays called PIE.

So if Aryan language speakers were already there in Eurasia by 3000 BC who were the people who are supposed to have come to India in the neolithic period? Does it mean that the language reached India by demic diffusion before 1500 BC as claimed by the Aryan Invasion Theory? If the language reached India earlier than 2000 BC (Neolithic) then the idea that the language reached Syria in 1800-1700 BC before going to India is falsified. That linguistic theory has to be discarded.

So one might ask "OK so what? maybe the language did reach India before 2000 BC and it did come from the West". This is a new form of Aryan Invasion theory that claims that the language came by demic diffusion along with Agriculture. The paper linked by Arun Gupta addresses this theory and says that this demic diffusion model of language spread is unlikely

The paper starts with the statement:
It is pertinent that paternal gene pool of India comprises mainly HGs of autochthonous origin of Late Pleistocene ancestry and received very little gene flow from outside

Hakeepm Saab, any reference for bold text in red?
shiv
BRF Oldie
Posts: 34981
Joined: 01 Jan 1970 05:30
Location: Pindliyon ka Gooda

Re: Out-of-India - From Theory to Truth: Part 2

Post by shiv »

^^
Two names come to mind. Cavalli-Sforza and Colin Renfrew but the link with agriculture is missing - so that part of my statement may be wrong unless I find some link
http://www.pnas.org/content/94/15/7719.full
(b) Subjection of a tribe or nation, by conquest or by economic and social control. This includes Renfrew’s “elite dominance” and “power collapse” (26).

In conquest by people with superior military power or skills there is usually no complete destruction of the subdued nations, but simply their submission and exploitation. After the development of agriculture, the earlier occupants are usually very numerous and retain a high majority after the invasion; genetically, there is then little change, except that the new masters reserve for themselves the positions of power and thus form the new aristocracy. A new strong genetic stratification of social classes is thus generated. The overall gene pool change may be modest, but will depend on two factors: the proportions of demographic contributions to the population of aborigines and newcomers and also on their relative growth rates, which may be unequal. The newcomers, especially if they are few and powerful, are likely to retain for themselves the best resources and have higher growth rates. Hypergamy, sex differential migration as discussed above, will complicate the final picture.

The new masters are likely to impose their language and thus generate a local discrepancy between the genetic and linguistic pictures. This, however, does not always take place. Even the most extensive demic expansions or conquests were not always effective in totally eradicating all of the languages spoken locally. In general, some relic languages survive in some peripheral areas of their original distribution after expansions of people speaking other languages. There are examples in refuge areas that survived the spread of Indo-European languages to Europe (Basque), northern Pakistan (Burushasky), India (Dravidian languages), and the Caucasus (Caucasian languages); interestingly, they may all belong to a family (Eurasian, different from Eurasiatic) that was spread more than 20,000 years ago to the whole area of Europe, Asia, and America. It has been suggested that this superfamily spread to all of Eurasia at the time of the first occupation of Europe, 40,000 years ago (27).
In contrast to this, the paper posted by Arun Gupta says
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4709632/
Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent.

That aside I find theories about language spread no different from the theory that says that the universe is filled with Aether that allows transmission of light waves. When there is no evidence of something, cooking up a non existent entity is a time tested way of explaining the ridiculous. There are dates available in Indian texts. There are zero dates available for IE languages anywhere else before 1500 BC. So the presence of languages and even their spread has simply been cooked up
Post Reply